The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise

Evaluation safety or possible risk of exercising

The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity. It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity. Those who to answer no to all questions will be included in the protocol study.

Time frame: baseline

Habitual Physical Activity Level

Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity. The questionnaire includes items about household activities, sport, and leisure time activities over the past year. The Sport Index is divided into four categories (\<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and \> 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes.

Time frame: Baseline

Evaluation of depression and anxiety symptoms

Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings. In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety.

Time frame: Baseline

Estimation the aerobic capacity

McArdle Step Test was developed to estimate the aerobic capacity of university students. For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective

Time frame: Baseline

Detection of the polymorphism in the SLC6A4

The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme. The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).

Time frame: Baseline

Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A)

The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs). From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.

Time frame: Baseline